Primer Detail
- Primer name
- TS-Fs5r
- Gene name
- ITS2- rRNA gene (ITS-rRNA gene)
- Primer sequence (5'-3')
- TCCTCCGCTTATTGATATGCTT
- Direction
- R
- Category
- specific primer
- Reference
- Mohammad Arif, Shilpi Chawla, NW Zaidi, JK Rayar, M Variar and US Singh (2012) Development of specific primers for genus Fusarium and F. solani using rDNA sub-unit and transcription elongation factor (TEF-1α) gene. African Journal of Biotechnology 11: 444-447.