Primer Detail
- Primer name
- ITS-Fu2f
- Gene name
- ITS1-5.8S-ITS2 rRNA gene (ITS)
- Primer sequence (5'-3')
- CCAGAGGACCCCCTAACTCT
- Direction
- F
- Category
- specific primer
- Reference
- Mohammad Arif, Shilpi Chawla, NW Zaidi, JK Rayar, M Variar and US Singh (2012) Development of specific primers for genus Fusarium and F. solani using rDNA sub-unit and transcription elongation factor (TEF-1α) gene. African Journal of Biotechnology 11: 444-447.