Primer Detail
- Primer name
- TEF-Fs4r
- Gene name
- translation elongation factor 1 alpha (TEF-1α)
- Primer sequence (5'-3')
- GGCGTCTGTTGATTGTTAGC
- Direction
- R
- Category
- specific primer
- Reference
- Mohammad Arif, Shilpi Chawla, NW Zaidi, JK Rayar, M Variar and US Singh (2012) Development of specific primers for genus Fusarium and F. solani using rDNA sub-unit and transcription elongation factor (TEF-1α) gene. African Journal of Biotechnology 11: 444-447.