Primer Detail
- Primer name
- VdMAT111R3
- Gene name
- mating-type gene (MAT1-1-1)
- Primer sequence (5'-3')
- GGCCTCCATGTTGTAAGCGT
- Reference
- Usami T, Itoh M and Amemiya Y (2009) Asexual fungus Verticillium dahliae is potentially heterothallic. Journal of General Plant Pathology 75: 422-427.
- Literature
- Papaioannou IA, Ligoxigakis EK, Vakalounakis DJ and Markakis (2013) Phytopathogenic, morphological, genetic and molecular characterization of a Verticillium dahliae population from Crete, Greece. European Journal of plant pathology 136: 577-596.