Primer Detail
- Primer name
- A1f
- Gene name
- Elongation factor 1 alpha (EF)
- Primer sequence (5'-3')
- AAGTGGAGCCCCGTATCTTGAAT
- Direction
- F
- Category
- specific primer
- Reference
- Patrik Inderbitzin, R Michael Davis, Richard M Bostock and Krishna V Subbarao (2013) Identification and Differentiation of Verticillium Species and V. longisporum Lineages by Simplex and Multiplex PCR Assays. PLoS One 8: e65990.