Primer Detail
- Primer name
- FMPh-8b
- Gene name
- mitochondrially encoded cytochrome oxidase I and II genes (cox2-cox1)
- Primer sequence (5'-3')
- AAAAGAGAAGGTGTTTTTTATGGA
- Direction
- F
- Category
- specific primer
- Target
- Phytophthora
- Reference
- Martin FN, Tooley PW and Blomquist C (2004) Molecular detection of Phytophthora ramorum, the causal agent of sudden oak death in California, and two additional species commonly recovered from diseased plant material. Phytopathology 94: 621-631.