Primer Detail
- Primer name
- AsAPH2B
- Gene name
- ITS1-5.8S-ITS2 rRNA gene (ITS)
- Primer sequence (5'-3')
- GCGCGTTGTTCACAATAAATTGC
- Direction
- R
- Category
- specific primer
- Paired primer
- AsPyF
- Reference
- Asano T, M Senda, H Suga and K Kageyama (2010) Development of multiplex PCR to detect five Pythium species related to turf-grass diseases. Journal of Phytopathology 158: 609-615.
- Literature
- Schroeder KL, Martin F, de Cock AWAM, Lévesque CA, Spies C Okubara P and Paulitz TC (2013) Molecular detection and quantification of Pythium species - Evolving taxonomy, new tools and challenges. Plant Disease 97: 4-20.
- Reference Strain
Aphanomyces iridis IFO 31934 Phytophthora capsici NBRC 30696 Phytophthora megasperma IFO 31624 Pythium acanthophoron MAFF 425319 Pythium dissotocum MAFF 305576 Pythium graminicola MAFF 305860, MAFF 425415 Pythium hydnosporum MAFF 305861, MAFF 305892 Pythium inflatum MAFF 305863, MAFF 425322 Pythium intermedium MAFF 305570, MAFF 425324 Pythium irregulare MAFF 305572 Pythium nodosum MAFF 305905 Pythium torulosum MAFF 305575 Pythium volutum IFO 31926, IFO 31927 Saprolegnia parasitica NBRC 32708