Primer Detail
- Primer name
- FM58
- Gene name
- mitochondrially encoded cytochrome oxidase II genes (coxII)
- Primer sequence (5'-3')
- CCACAAATTTCACTACATTGA
- Reference
- Martin FN (2000) Phylogenetic relationships among some Pythium species inferred from sequence analysis of the mitochondrially encoded cytochrome oxidase II gene. Mycologia 92: 711-727.
- Literature
- Kelly L IVORS, Katherine J HAYDEN, Peter JM BONANTS and David M RIZZO (2004) AFLP and phylogenetic analyses of North American and European populations of Phytophthora ramorum. Mycological Research 108: 378-392.