Primer Detail
- Primer name
- IgCoxR
FMPh-10b - Gene name
- mitochondrially encoded cytochrome oxidase I and II genes (cox2-cox1)
- Primer sequence (5'-3')
- GCAAAAGCACTAAAAATTAAATATAA
- Direction
- R
- Reference
- Martin FN, Tooley PW and Blomquist C (2004) Molecular detection of Phytophthora ramorum, the causal agent of sudden oak death in California, and two additional species commonly recovered from diseased plant material. Phytopathology 94: 621-631.
- Literature
- Xavier Giresse, Sophia Ahmed, Sylvie Richard-Cervera and François Delmotte (2010) Development of New Oomycete Taxon-specific Mitochondrial Cytochrome b Region Primers for Use in Phylogenetic and Phylogeographic Studies. Journal of Phytopathology 158: 321-327.
- Schena L and Cooke DEL (2006) Assessing the potential of regions of the nuclear and mitochondrial genome to develop a "molecular tool box" for the detection and characterization of Phytophthora species. 67: 70-85.