Primer Detail
- Gene name
- mitochondrially encoded cytochrome oxidase II genes (cox2)
- Primer sequence (5'-3')
- CCATGATTAATACCACAAATTTCACTAC
- Direction
- R
- Reference
- Hudspeth DSS, Nadler SA and Hudspeth MES (2000) A cox2 molecular phylogeny of the peronosporomycetes. Mycologia 92: 674-684.
- Literature
- Xavier Giresse, Sophia Ahmed, Sylvie Richard-Cervera and François Delmotte (2010) Development of New Oomycete Taxon-specific Mitochondrial Cytochrome b Region Primers for Use in Phylogenetic and Phylogeographic Studies. Journal of Phytopathology 158: 321-327.