Primer Detail
- Primer name
- COXF4N
- Gene name
- mitochondrially encoded cytochrome oxidase I genes (cox1)
- Primer sequence (5'-3')
- GTATTTCTTCTTTATTAGGTGC
- Direction
- F
- Reference
- Kroon LP1, Bakker FT, van den Bosch GB, Bonants PJ and Flier WG (2004) Phylogenetic analysis of Phytophthora species based on mitochondrial and nuclear DNA sequences. Fungal Genetics and Biology 41: 766-782.
- Literature
- Xavier Giresse, Sophia Ahmed, Sylvie Richard-Cervera and François Delmotte (2010) Development of New Oomycete Taxon-specific Mitochondrial Cytochrome b Region Primers for Use in Phylogenetic and Phylogeographic Studies. Journal of Phytopathology 158: 321-327.