Primer Detail
- Primer name
 - IntronRas R
 - Gene name
 - ras gene
 - Primer sequence (5'-3')
 - TGCACGTACTATTCGGGGTTC
 - Direction
 - R
 - Reference
 - Gómez-Alpizar L1, Hu CH, Oliva R, Forbes G and Ristaino JB (2008) Phylogenetic relationships of Phytophthora andina, a new species from the highlands of Ecuador that is closely related to the Irish potato famine pathogen Phytophthora infestans. Mycologia 100: 590-602.