Primer Detail
- Primer name
- IntronRas R
- Gene name
- ras gene
- Primer sequence (5'-3')
- TGCACGTACTATTCGGGGTTC
- Direction
- R
- Reference
- Gómez-Alpizar L1, Hu CH, Oliva R, Forbes G and Ristaino JB (2008) Phylogenetic relationships of Phytophthora andina, a new species from the highlands of Ecuador that is closely related to the Irish potato famine pathogen Phytophthora infestans. Mycologia 100: 590-602.