Primer Detail
- Primer name
- FM83
- Gene name
- mitochondrially encoded cytochrome oxidase I genes (coxI)
- Primer sequence (5'-3')
- CTCCAATAAAAAATAACCAAAAATG
- Direction
- R
- Reference
- NO Villa, K Kageyama, T Asano and H Suga (2006) Phylogenetic relationships of Pythium and Phytophthora species based on ITS rDNA, cytochrome oxidase II and β-tubulin gene sequences. Mycologia 98: 410-422.
- Literature
- Martin FN and Tooley PW (2003) Phylogenetic relationships among Phytophthora species inferred from sequence analysis of mitochondrially encoded cytochrome oxidase I and II genes. Mycologia 95: 269-284.