Primer Detail
- Primer name
- forward
- Gene name
- cytochrome oxidase mitochondrial gene I (coxI)
- Primer sequence (5'-3')
- CCACCCCATAAAGTAGCTAACC
- Direction
- F
- Reference
- Hurtado-Gonzales OP, Aragon-Caballero LM, Flores-Torres JG, Man in't Veld W and Lamour KH (2009) Molecular comparison of natural hybrids of Phytophthora nicotianae and P. cactorum infecting loquat trees in Peru and Taiwan. Mycologia 101: 496-502.