Primer Detail
- Primer name
- PN-F
- Gene name
- Elicitin gene parA1
- Primer sequence (5'-3')
- CCACCACGCAGCAAACTGCGGC
- Direction
- F
- Category
- specific primer
- Reference
- Kong P, Hong C, Jeffers SN and Richardson PA (2003) A Species-Specific Polymerase Chain Reaction Assay for Rapid Detection of Phytophthora nicotianae in Irrigation Water. Phytopathology 93: 822-831.
- Literature
- Mingzhu Li, Takahiro Asano, Haruhisa Suga and Koji Kageyama (2011) A Multiplex PCR for the Detection of Phytophthora nicotianae and P. cactorum, and a Survey of Their Occurrence in Strawberry Production Areas of Japan. Plant Disease 95: 1270-1278.
- Reference Strain
Phytophthora capsici NBRC 30696 Phytophthora cinnamomi NBRC 33182 Phytophthora sojae NBRC 31016 Pythium irregulare NBRC 100108 Pythium myriotylum NBRC 100113 Pythium paddicum NBRC 31993 Pythium pyrilobum NBRC 32560 Pythium spinosum NBRC 100116 Pythium sylvaticum NBRC 100119 Pythium ultimum NBRC 100123 Saprolegnia parasitica NBRC 32708