Primer Detail
- Primer name
- 18S69F
18S-69F - Gene name
- 18S rRNA gene (SSU)
- Primer sequence (5'-3')
- CTGCGAATGGCTCATTAAATCAGT
- Direction
- F
- Target
- fungi
- Literature
- Mingzhu Li, Takahiro Asano, Haruhisa Suga and Koji Kageyama (2011) A Multiplex PCR for the Detection of Phytophthora nicotianae and P. cactorum, and a Survey of Their Occurrence in Strawberry Production Areas of Japan. Plant Disease 95: 1270-1278.
- Mingzhu Li, Minoru Inada, Hideki Watanabe, Haruhisa Suga and Koji Kageyama (2013) Simultaneous Detection and Quantification of Phytophthora nicotianae and P. cactorum, and Distribution Analyses in Strawberry Greenhouses by Duplex Real-time PCR. Microbes and Environments 28: 195-203.
- Asano T, M Senda, H Suga and K Kageyama (2010) Development of multiplex PCR to detect five Pythium species related to turf-grass diseases. Journal of Phytopathology 158: 609-615.
- Reference Strain
Aphanomyces iridis IFO 31934 Phytophthora capsici NBRC 30696 Phytophthora cinnamomi NBRC 33182 Phytophthora megasperma IFO 31624 Phytophthora sojae NBRC 31016 Pythium acanthophoron MAFF 425319 Pythium dissotocum MAFF 305576 Pythium graminicola MAFF 305860, MAFF 425415 Pythium hydnosporum MAFF 305861, MAFF 305892 Pythium inflatum MAFF 305863, MAFF 425322 Pythium intermedium MAFF 305570, MAFF 425324 Pythium irregulare MAFF 305572, NBRC 100108 Pythium myriotylum NBRC 100113 Pythium nodosum MAFF 305905 Pythium paddicum NBRC 31993 Pythium pyrilobum NBRC 32560 Pythium spinosum NBRC 100116 Pythium sylvaticum NBRC 100119 Pythium torulosum MAFF 305575 Pythium ultimum NBRC 100123 Pythium volutum IFO 31926, IFO 31927 Saprolegnia parasitica NBRC 32708