Primer Detail
- Primer name
- Type-IIR
- Gene name
- mating-type gene
- Primer sequence (5'-3')
- ACGTGCATCCAAGAAGACGC
- Direction
- R
- Category
- Inv+ specific primer
- Reference
- Periasamy Chitrampalam, Patrik Inderbitzin, Karunakaran Maruthachalam, Bo-Ming Wu and Krishna V Subbarao (2013) The Sclerotinia sclerotiorum mating type locus (MAT) contains a 3.6-kb region that is inverted in every meiotic generation. PLoS One e56895.