Primer Detail
- Primer name
- GFmat1b
- Gene name
- mating-type gene
- Primer sequence (5'-3')
- TAAGCGCCCTCTTAACGCCTTC
- Category
- specific primer
- Reference
- Emma T Steenkamp, Brenda D Wingfield, Teresa A Coutinho, Kurt A Zeller, Michael J Wingfield, Walter FO Marasas and John F Leslie (2000) PCR-Based Identification of MAT-1 and MAT-2 in the Gibberella fujikuroi Species Complex. Applied and Environmental Microbiology 66: 4378-4382.