Primer Detail
- Primer name
- Fo14
- Gene name
- mating-type gene
- Primer sequence (5'-3')
- ATATGGAGCAGTGATTGGAC
- Direction
- R
- Reference
- Arie T, Kaneko I, Yoshida T, Noguchi M, Nomura Y and Yamaguchi I (2000) Mating-type genes from asexual phytopathogenic ascomycetes Fusarium oxysporum and Alternaria alternata. Molecular Plant-Microbe Interactions 13: 1330-1339.
- Literature
- Emma T Steenkamp, Brenda D Wingfield, Teresa A Coutinho, Kurt A Zeller, Michael J Wingfield, Walter FO Marasas and John F Leslie (2000) PCR-Based Identification of MAT-1 and MAT-2 in the Gibberella fujikuroi Species Complex. Applied and Environmental Microbiology 66: 4378-4382.
- Reference Strain
Fusarium oxysporum f. sp. lycopersici MAFF 103042, MAFF 103043, MAFF 305121, MAFF 305559, MAFF 727501, MAFF 744006 Fusarium oxysporum f. sp. lycopersici race 1 MAFF 103036 Fusarium oxysporum f. sp. lycopersici race 2 MAFF 103038 Fusarium oxysporum f. sp. melongenae MAFF 103051 Fusarium oxysporum f. sp. radicis-lycopersici MAFF 103044, MAFF 103047