PriMicro Database

For classification, identification and molecular phylogenetic analyses of microbes

Primer Detail

Primer name
Fo52
Gene name
mating-type gene
Primer sequence (5'-3')
AATTTGGGAAGACGAGAGAGTT
Direction
R
Reference
Arie T, Kaneko I, Yoshida T, Noguchi M, Nomura Y and Yamaguchi I (2000) Mating-type genes from asexual phytopathogenic ascomycetes Fusarium oxysporum and Alternaria alternata. Molecular Plant-Microbe Interactions 13: 1330-1339.
Reference Strain
Fusarium oxysporum f. sp. lycopersiciMAFF 103042, MAFF 103043, MAFF 305121, MAFF 305559, MAFF 727501, MAFF 744006
Fusarium oxysporum f. sp. lycopersici race 1MAFF 103036
Fusarium oxysporum f. sp. lycopersici race 2MAFF 103038
Fusarium oxysporum f. sp. melongenaeMAFF 103051
Fusarium oxysporum f. sp. radicis-lycopersiciMAFF 103044, MAFF 103047