Primer Detail
- Primer name
- EF1 Foc
EF1
- Gene name
- mating-type gene (MAT-2)
- Primer sequence (5'-3')
- GTATCTTCTGTCCACCACAG
- Reference
- Visser M (2003) Molecular biological studies of the Fusarium wilt pathogen of banana in South Africa. Ph.D. dissertation. University of Pretoria, Pretoria, South Africa Chapter2:
- Literature
- Gerda Fourie, ET Steenkamp, TR Gordon and A Viljoen (2009) Evolutionary relationships among the Fusarium oxysporum f. sp. cubense vegetative compatibility groups. Applied and Environmental Microbiology 75: 4770-4781.
