Primer Detail
- Primer name
- Falpha2
- Gene name
- mating-type gene (MAT-1)
- Primer sequence (5'-3')
- GATGTAGATGGAGGGTTCAA
- Direction
- R
- Reference
- Hirano Y and Arie T (2009) Variation and phylogeny of Fusarium oxysporum isolates based on nucleotide sequences of polygalacturonase genes. Microbes Environments 24: 113-120.
- Arie T, Kaneko I, Yoshida T, Noguchi M, Nomura Y and Yamaguchi I (2000) Mating-type genes from asexual phytopathogenic ascomycetes Fusarium oxysporum and Alternaria alternata. Molecular Plant-Microbe Interactions 13: 1330-1339.
- Literature
- Gerda Fourie, ET Steenkamp, TR Gordon and A Viljoen (2009) Evolutionary relationships among the Fusarium oxysporum f. sp. cubense vegetative compatibility groups. Applied and Environmental Microbiology 75: 4770-4781.
- Michael J Southwood, Altus Viljoen, Lizel Mostert, Lindy J Rose and Adéle McLeod (2012) Phylogenetic and biological characterization of Fusarium oxysporum isolates associated with onion in south Africa. Plant Disease 96: 1250-1261.
- Emma T Steenkamp, Brenda D Wingfield, Teresa A Coutinho, Kurt A Zeller, Michael J Wingfield, Walter FO Marasas and John F Leslie (2000) PCR-Based Identification of MAT-1 and MAT-2 in the Gibberella fujikuroi Species Complex. Applied and Environmental Microbiology 66: 4378-4382.
- Kawabe M, Kobayashi Y, Okada G, Yamaguchi I, Teraoka T and Arie T (2005) Three evolutionary lineages of tomato wilt pathogen, Fusarium oxysporum f. sp. lycopersici, based on sequences of IGS, MAT1, and pg1, are each composed of isolates of a single mating type and a single or closely related vegetative compatibility group. Journal of General Plant Pathology 71: 263-272.
- Reference Strain
Fusarium oxysporum f. sp. batatas MAFF 103070 Fusarium oxysporum f. sp. colocasiae MAFF 744032, MAFF 744035 Fusarium oxysporum f. sp. conglutinans MAFF 727516, MAFF 744001 Fusarium oxysporum f. sp. cucumerinum MAFF 103054, MAFF 744005 Fusarium oxysporum f. sp. dianthi MAFF 103072, MAFF 305946 Fusarium oxysporum f. sp. fragariae MAFF 305557, MAFF 727510, MAFF 744009 Fusarium oxysporum f. sp. lactucae MAFF 744028, MAFF 744029 Fusarium oxysporum f. sp. lagenariae MAFF 103008, MAFF 744002 Fusarium oxysporum f. sp. lycopersici MAFF 103042, MAFF 103043, MAFF 305121, MAFF 305559, MAFF 727501, MAFF 744006 Fusarium oxysporum f. sp. lycopersici race 1 MAFF 103036 Fusarium oxysporum f. sp. lycopersici race 2 MAFF 103038 Fusarium oxysporum f. sp. melongenae MAFF 103051 Fusarium oxysporum f. sp. melonis MAFF 305122, MAFF 305544 Fusarium oxysporum f. sp. niveum MAFF 305543, MAFF 305608, NBRC 9969 Fusarium oxysporum f. sp. phaseoli MAFF 235727, NBRC 9970 Fusarium oxysporum f. sp. radicis-lycopersici MAFF 103044, MAFF 103047 Fusarium oxysporum f. sp. raphani MAFF 103058, MAFF 305124 Fusarium oxysporum f. sp. spinaciae MAFF 103059, MAFF 731044 Fusarium oxysporum f. sp. tracheiphilum MAFF 235725, MAFF 235726 Fusarium oxysporum f. sp. tulipae MAFF 235105, MAFF 235109