Primer Detail
- Primer name
- PNFo
- Gene name
- rRNA intergenic spacer region (IGS)
- Primer sequence (5'-3')
- CCCGCCTGGCTGCGTCCGACTC
- Reference
- Edel V, C Steinberg, I Avelange, G Laguerre and C Alabouvette (1995) Comparison of three molecular methods for the characterization of Fusarium oxysporum strains. Phytopathology 85: 579-585.
- Literature
- Gerda Fourie, ET Steenkamp, TR Gordon and A Viljoen (2009) Evolutionary relationships among the Fusarium oxysporum f. sp. cubense vegetative compatibility groups. Applied and Environmental Microbiology 75: 4770-4781.
- Michael J Southwood, Altus Viljoen, Lizel Mostert, Lindy J Rose and Adéle McLeod (2012) Phylogenetic and biological characterization of Fusarium oxysporum isolates associated with onion in south Africa. Plant Disease 96: 1250-1261.
- Reference Strain
Colletotrichum asianum MAFF 306627 Colletotrichum boninense MAFF 305972 Colletotrichum horii MAFF 306492, NBRC 7478 Colletotrichum tropicale MAFF 239933