Primer Detail
- Primer name
- AspR1
- Gene name
- mitochondrial cytochrome c oxidase 1 (CO1)
- Primer sequence (5'-3')
- GGTAATGATAATAATAATAATACAGCTG
- Direction
- R
- Category
- specific primer
- Reference
- Seifert KA, Samson RA, Dewaard JR, Houbraken J, Lévesque CA, Moncalvo JM, Louis-Seize G and Hebert PD (2007) Prospects for fungus identification using CO1 DNA barcodes, with Penicillium as a test case. Proceedings of the National Academy of Sciences 104: 3901-3906.