Primer Detail
- Primer name
- Mat1-F
- Gene name
- (mat1-1)
- Primer sequence (5'-3')
- GTGACCAGGAAACAGCTATGACCGGAGTGTGTTGATCGTGG
- Direction
- F
- Literature
- Leroch M, Plesken C, Weber RW, Kauff F, Scalliet G and Hahn M (2013) Gray mold populations in german strawberry fields are resistant to multiple fungicides and dominated by a novel clade closely related to Botrytis cinerea. Applied and Environmental Microbiology 79: 159-167.