Primer Detail
- Primer name
- URP13R
- Gene name
- universal rice primers (URP)
- Primer sequence (5'-3')
- TACATCGCAAGTGACACAGG
- Category
- universal rice primers
- Literature
- N González, G Godoy-Lutz, JR Steadman, R Higgins and KM Eskridge (2012) Assessing genetic diversity in the web blight pathogen Thanatephorus cucumeris (anamorph = Rhizoctonia solani) subgroups AG-1-IE and AG-1-IF with molecular markers. Journal of General Plant Pathology 78: 85-98.