Primer Detail
- Primer name
- 18S uni-R
- Gene name
- 18S rRNA gene (SSU)
- Primer sequence (5'-3')
- CCACCACCCATAGAATCAAGA
- Direction
- R
- Category
- qPCR probe
- Target
- universal
- Reference
- Ioos R, Fabre B, Saurat C, Fourrier C, Frey P and Marçais B (2010) Development, comparison, and validation of real-time and conventional PCR tools for the detection of the fungal pathogens causing brown spot and red band needle blights of pine. Phytopathology 100: 105-114.