Primer Detail
- Primer name
- EF2T
- Gene name
- translation elongation factor 1 alpha intron (EF1α)
- Primer sequence (5'-3')
- GGAAGTACCAGTGATCATGTT
- Direction
- R
- Literature
- Bischoff JF, Rehner SA and Humber RA (2006) Metarhizium frigidum sp. nov.: a cryptic species of M. anisopliae and a member of the M. flavoviride complex. Mycologia 98: 737-745.
- Gladys Y Mbofung, Soon Gyu Hong and Barry M Pryor (2007) Phylogeny of Fusarium oxysporum f. sp. lactucae Inferred from mitochondrial small subunit, elongation factor 1-α, and nuclear ribosomal intergenic spacer sequence data. Phytopathology 97: 87-98.
- Wang C, Lin Y, Lin Y and Chung W (2013) Modified primers for the identification of nonpathogenic Fusarium oxysporum isolates that have biological vontrol potential against Fusarium wilt of cucumber in Taiwan. PLoS One 8: e65093.