Primer Detail
- Primer name
- VANS1
- Gene name
- 18S rRNA gene (SSU)
- Primer sequence (5'-3')
- GTCTAGTATAATCGTTATACAGG
- Direction
- F
- Category
- taxon specific
- Target
- vesicular-arbuscular endomycorrhizal fungus (level of order)
- Paired primer
- NSVA340
- Reference
- Simon L, Lalonde M and Bruns TD (1992) Specific amplification of 18S ribosomal genes from VA endomycorrhizal fungi colonizing roots. Applied and Environmental Microbiology 58: 291-295.
- Literature
- Dirk Redecker (2000) Specific PCR primers to identify arbuscular mycorrhizal fungi within colonized roots. Mycorrhiza 10: 73-80.
- Clapp JP, Fitter AH and Young JPW (1999) Ribosomal small subunit sequence variation within spores of an arbuscular mycorrhizal fungus, Scutellospora sp. Molecular Ecology 8: 915-921.
- Dirk Redecker, Isabelle Hijri and Andres Wiemken (2003) Molecular identification of arbuscular mycorrhizal fungi in roots: Perspectives and problems. Folia Geobotanica 38: 113-124.
- Clapp JP, Young JPW, Merryweather JW and Fitter AH (1995) Diversity of fungal symbionts in arbuscular mycorrhizas from a natural community. New Phytologist 130: 259-265.