Primer Detail
- Primer name
- ITS2-KL
- Gene name
- ITS1-5.8S-ITS2 rRNA gene (ITS)
- Primer sequence (5'-3')
- ATGCTTAAGTTCAGCGGGTA
- Category
- fungus-specific
- Target
- fungi
- Reference
- Lohtander K, Myllys L, Sundin R, Mari Källersjö and Tehler A (1998) The species pair concept in the lichen Dendrographa leucophaea (Arthoniales):Analyses based on ITS sequences. Bryologist 101: 404-411.
- Literature
- Myllys, L., Lohtander, K. and Tehler, A (2001) β-tublin, ITS and group I intron sequences challenge the species pair concept in Physcia aipolia and P. caesia. Mycologia 93: 335-343.
- Leena Myllys, Katileena Lohtander, Mari Källersjö and Anders Tehler (1999) Sequence insertion and ITS data provide congruent information in Roccella canariensis and R. tuberculata (Arthoniales, Euascomycetes) phylogeny. Molecular Phylogenetics and Evolution 12: 295-309.