Primer Detail
- Primer name
- X756R
- Gene name
- 28S rRNA gene (LSU)
- Primer sequence (5'-3')
- CCGAAGCTCCCACCTCCGTT
- Category
- species specific
- Target
- fungi
- Reference
- Constantino Ruibal, Ana M. Millanes and David L Hawksworth (2011) Molecular phylogenetic studies on the lichenicolous Xanthoriicola physciae reveal Antarctic rock-inhabiting fungi and Piedraia species among closest relatives in the Teratosphaeriaceae. IMA Fungus 2(1): 97-103.