Primer Detail
- Primer name
- EF3
- Primer sequence (5'-3')
- TCCTCTAAATGACCAAGTTTG
- Category
- species specific
- Target
- fungi
- Paired primer
- EF4
- Reference
- Eric Smit, Paula Leeflang, Boet Glandorf, Jan Dirk Van Elsas and Karel Wernars (1999) Analysis of fungal diversity in the wheat rhizosphere by sequencing of cloned PCR-amplified genes encoding 18S rRNA and temperature gradient gel electrophoresis. Applied and Environmental Microbiology 65(6): 2614-2621.
- Literature
- James Borneman and R. Jack Hartin (2000) PCR primers that amplify fungal rRNA genes from environmental samples. Applied and Environmental Microbiology 66(10): 4356-4360.
- Valášková V and Baldrian P (2009) Denaturing gradient gel electrophoresis as a fingerprinting method for the analysis of soil microbial communities. JournalPlant, Soil and Environment 55(10): 413-423.