Primer Detail
- Primer name
- VANS1
- Primer sequence (5'-3')
- GTCTAGTATAATCGTTATACAGG
- Direction
- F
- Category
- taxon specific
- Paired primer
- EF4
- Reference
- Simon L, Lalonde M and Bruns TD (1992) Specific amplification of 18S ribosomal genes from VA endomycorrhizal fungi colonizing roots. Applied and Environmental Microbiology 58: 291-295.
- Literature
- James Borneman and R. Jack Hartin (2000) PCR primers that amplify fungal rRNA genes from environmental samples. Applied and Environmental Microbiology 66(10): 4356-4360.
- Dirk Redecker, Joseph B. Morton and Thomas D. Bruns (2000) Ancestral lineages of arbuscular mycorrhizal fungi (Glomales). Molecular Phylogenetics and Evolution 14: 276-284.
- Simon L, Levesque RC and Lalonde M (1995) Rapid quantitation by PCR of endomycorrhizal fungi colonising roots. PCR Methods and Applications 2: 76-80.
- L Simon, R C Lévesque, and M Lalonde (1993) Identification of endomycorrhizal fungi colonizing roots by fluorescent single-strand conformation polymorphism-polymerase chain reaction. Applied and Environmental Microbiology 59(12): 4211-4215.