PriMicro Database

For classification, identification and molecular phylogenetic analyses of microbes

Primer Detail

Primer name
Bt2b
BT2B
BT2b/Bt-2b/bt2b
Gene name
β-Tubulin (BT)
Primer sequence (5'-3')
ACCCTCAGTGTAGTGACCCTTGGC
Direction
R
Target
filamentous ascomycetes
Reference
Glass NL, Donaldson GC (1995) Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Applied and Environmental Microbiology 61: 1323-1330.
Literature
K. Tanaka, K. Hirayama, H. Yonezawa, S. Hatakeyama, Y. Harada, T. Sano, T. Shirouzu and T. Hosoya (2009) Molecular taxonomy of bambusicolous fungi: Tetraplosphaeriaceae, a new pleosporalean family with Tetraploa-like. Studies in Mycology 64: 175-209.
A.J.L. Phillips, A. Alves, S.R. Pennycook, P.R. Johnston, A. Ramaley, A. Akulov and P.W. Crous (2008) Resolving the phylogenetic and taxonomic status of dark-spored teleomorph genera in the Botryosphaeriaceae. Persoonia 21: 29-55.
Alga Zuccaro, Conrad L. Schoch, Joseph W. Spatafora, Jan Kohlmeyer, Siegfried Draeger and Julian I. Mitchell (2008) Detection and Identification of Fungi Intimately Associated with the Brown Seaweed Fucus serratus. Applied and Environmental Microbiology 74(4): 931-941.
Panelli S. Buffoni JN, Bonacina C and Feligini M (2012) Identification of moulds from the Taleggio cheese environment by the use of DNA barcodes. Food Control 28: 385-391.
Crous PW, Groenewald JZ, Risède J-M, Simoneau P and Hywel-Jones NL (2004) Calonectria species and their Cylindrocladium anamorphs: species with sphaeropedunculate vesicles. Studies in Mycology 50: 415-430.
Houbraken J, Spierenburg H, Frisvad JC (2012) Rasamsonia, a new genus comprising thermotolerant and thermophilic Talaromyces and Geosmithia species. Antonie van Leeuwenhoek 101: 403-421.
López-Villavicencio M, Aguileta G, Giraud T, de Vienne DM, Lacoste S, Couloux A and Dupont J (2010) Sex in Penicillium: combined phylogenetic and experimental approaches. Fungal Genetics and Biology 47: 693-706.
Hong SB, Cho HS, Shin HD, Frisvad JC and Samson RA (2006) Novel Neosartorya species isolated from soil in Korea. International Journal of Systematic and Evolutionary Microbiology 56: 477-486.
Irene Barnes, Pedro W. Crous, Brenda D. Wingfield and Michael J. Wingfield (2004) Multigene phylogenies reveal that red band needle blight of Pinus is caused by two distinct species of Dothistroma, D. septosporum and D. pini. Studies in Mycology 50: 551-565.
Groenewald JZ, Nakashima C, Nishikawa J, Shin HD, Park JH, Jama AN, Groenewald M, Braun U and Crous PW (2013) Species concepts in Cercospora: spotting the weeds among the roses. Studies in Mycology 75: 115-170.
Davidson RM, Hanson LE, Franc GD and Panella L (2006) Analysis of β-tubulin gene fragments from benzimidazole sensitive and tolerant Cercospora beticola. Journal of Phytopathology 154: 321-328.
Andjic A, Whyte G, Hardy GESJ and Burgess TI (2010) New Teratosphaeria species occurring on eucalypts in Australia. Fungal Diversity 43: 27-38.
Rivera KG and Seifert KA (2011) A taxonomic and phylogenetic revision of the Penicillium sclerotiorum complex. Studies in Mycology 70: 139-158.
BS Weir, PR Johnston and U Damm (2012) The Colletotrichum gloeosporioides species complex. Studies in Mycology 73: 115-180.
Toyozo Sato and Jouji Moriwaki (2013) Molecular re-identification of strains in NIAS Genebank belonging to phylogenetic groups A2 and A4 of the Colletotrichum acutatum species complex. Microbiology and Culture Collections 29: 13-23.
T Sato, J Moriwaki and T Misawa (2013) Molecular re-identification of strains of the Colletotrichum acutatum species complex deposited in the NIAS Genebank and morphological characteristics of its member species. Japan Agricultural Research Quarterly 47: 295-305.
Reference Strain
Astrosphaeriella aggregataMAFF 239485, MAFF 239486
Astrosphaeriella stellataMAFF 239487
Cercospora apiiIMI 077043, IMI 161116, MAFF 235978, MAFF 238072, MAFF 238299
Cercospora begoniaeMAFF 237690
Cercospora beticolaMAFF 238206, MAFF 305036
Cercospora capsiciMAFF 238227
Cercospora citrullinaMAFF 237872, MAFF 237913, MAFF 238205
Cercospora corchoriMAFF 238191
Cercospora ipomoeaeMAFF 239409
Cercospora kikuchiiMAFF 305039, MAFF 305040
Cercospora lactucae-sativaeMAFF 237719, MAFF 238209
Cercospora psophocarpicolaMAFF 305757
Cercospora richardiicolaMAFF 238210
Cercospora vignigenaMAFF 237635
Cercospora zinniaeMAFF 237718
Colletotrichum acutatumMAFF 238555, MAFF 744062, MAFF 744063
Colletotrichum carthamiMAFF 239355, MAFF 239356, MAFF 239357, MAFF 239358, MAFF 239359, MAFF 239360, MAFF 239361, MAFF 239362, MAFF 239364, MAFF 239365, MAFF 239366, MAFF 239367, MAFF 239368, MAFF 239369, MAFF 239370, MAFF 239371, MAFF 239372, MAFF 239373, MAFF 239374
Colletotrichum chrysanthemiMAFF 239363
Colletotrichum destructivumMAFF 306736
Colletotrichum fioriniaeMAFF 237130, MAFF 237215, MAFF 237216, MAFF 237217, MAFF 237218, MAFF 237240, MAFF 237758, MAFF 238519, MAFF 238652, MAFF 238653, MAFF 238654, MAFF 238655, MAFF 238947, MAFF 239142, MAFF 239279, MAFF 239399, MAFF 240052, MAFF 240192, MAFF 240389
Colletotrichum fructicolaMAFF 306735
Colletotrichum godetiaeMAFF 240289, MAFF 241295, MAFF 241296, MAFF 241297, MAFF 306506
Colletotrichum nymphaeaeMAFF 239773, MAFF 241261, MAFF 241293, MAFF 241294, MAFF 242413, MAFF 242414, MAFF 242415, MAFF 242416, MAFF 242417, MAFF 242418, MAFF 242419, MAFF 242430, MAFF 242581, MAFF 242590, MAFF 306406, MAFF 306407, MAFF 306430, MAFF 306487, MAFF 306488
Colletotrichum scovilleiMAFF 242420, MAFF 242421, MAFF 242422, MAFF 242425, MAFF 242426, MAFF 242427, MAFF 242428, MAFF 242592, MAFF 242692, MAFF 242693, MAFF 243021, MAFF 243022, MAFF 243038
Colletotrichum siamenseMAFF 242619, MAFF 242620
Colletotrichum sloaneiMAFF 239736
Colletotrichum sp.(B)MAFF 237894, MAFF 306172
Colletotrichum sp.(C)MAFF 240237
Colletotrichum sp.(J)MAFF 237922, MAFF 306725, MAFF 306726, MAFF 410809
Colletotrichum tropicaleMAFF 306096
Kalmusia scabrisporaJCM 12851, MAFF 239517, NBRC 106237
Katumotoa bambusicolaJCM 13131, MAFF 239641
Lasiodiplodia theobromaeMAFF 238880
Massarina arundinariaeMAFF 239461, NBRC 106238, NBRC 106239
Ophiosphaerella sasicolaJCM 13134, MAFF 239644
Phaeosphaeria brevisporaMAFF 239276, NBRC 106240
Phaeosphaeria sp.NBRC 106255
Polyplosphaeria fuscaJCM 13173, JCM 13175, JCM 13176, JCM 13177, MAFF 239683, MAFF 239685, MAFF 239686, MAFF 239687
Pseudotetraploa curviappendiculataJCM 12852, MAFF 239495, MAFF 239496, NBRC 106241
Pseudotetraploa javanicaJCM 12854, MAFF 239498
Pseudotetraploa longissimaJCM 12853, MAFF 239497
Quadricrura meridionalisNBRC 106242
Quadricrura septentrionalisNBRC 106243, NBRC 106244
Rasamsonia cylindrosporaIMI 071623, JCM 23136, NBRC 8110
Rasamsonia emersoniiIFM 48182, IFM 52961, IMI 105413, IMI 116815, IMI 154228, JCM 23024, NBRC 31070, NBRC 31159, NBRC 31169, NBRC 31232
Roussoella hysterioidesJCM 13126, MAFF 239636
Roussoella pustulansJCM 13127, MAFF 239637
Roussoella sp.NBRC 106245
Roussoellopsis sp.NBRC 106246
Roussoellopsis tosaensisJCM 13128, MAFF 239638
Tetraploa sp.JCM 14424, NBRC 106251
Tetraplosphaeria nagasakiensisJCM 13168, MAFF 239678
Tetraplosphaeria sasicolaJCM 13167, MAFF 239677
Triplosphaeria cylindricaJCM 13169, JCM 14425, MAFF 239679, NBRC 106247
Triplosphaeria maximaJCM 13172, MAFF 239682
Triplosphaeria sp.NBRC 106248, NBRC 106249
Trisplophaeria acutaJCM 13171, MAFF 239681
Versicolorisporium triseptatumJCM 14775