Primer Detail
- Primer name
- Bt2a
BT2a
bt2a - Gene name
- β-Tubulin (BT/benA)
- Primer sequence (5'-3')
- GGTAACCAAATCGGTGCTGCTTTC
- Direction
- F
- Target
- filamentous ascomycetes
- Reference
- Glass NL, Donaldson GC (1995) Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Applied and Environmental Microbiology 61: 1323-1330.
- Literature
- A.J.L. Phillips, A. Alves, S.R. Pennycook, P.R. Johnston, A. Ramaley, A. Akulov and P.W. Crous (2008) Resolving the phylogenetic and taxonomic status of dark-spored teleomorph genera in the Botryosphaeriaceae. Persoonia 21: 29-55.
- Panelli S. Buffoni JN, Bonacina C and Feligini M (2012) Identification of moulds from the Taleggio cheese environment by the use of DNA barcodes. Food Control 28: 385-391.
- Houbraken J, Spierenburg H, Frisvad JC (2012) Rasamsonia, a new genus comprising thermotolerant and thermophilic Talaromyces and Geosmithia species. Antonie van Leeuwenhoek 101: 403-421.
- López-Villavicencio M, Aguileta G, Giraud T, de Vienne DM, Lacoste S, Couloux A and Dupont J (2010) Sex in Penicillium: combined phylogenetic and experimental approaches. Fungal Genetics and Biology 47: 693-706.
- Hong SB, Cho HS, Shin HD, Frisvad JC and Samson RA (2006) Novel Neosartorya species isolated from soil in Korea. International Journal of Systematic and Evolutionary Microbiology 56: 477-486.
- Irene Barnes, Pedro W. Crous, Brenda D. Wingfield and Michael J. Wingfield (2004) Multigene phylogenies reveal that red band needle blight of Pinus is caused by two distinct species of Dothistroma, D. septosporum and D. pini. Studies in Mycology 50: 551-565.
- Groenewald JZ, Nakashima C, Nishikawa J, Shin HD, Park JH, Jama AN, Groenewald M, Braun U and Crous PW (2013) Species concepts in Cercospora: spotting the weeds among the roses. Studies in Mycology 75: 115-170.
- Davidson RM, Hanson LE, Franc GD and Panella L (2006) Analysis of β-tubulin gene fragments from benzimidazole sensitive and tolerant Cercospora beticola. Journal of Phytopathology 154: 321-328.
- Andjic A, Whyte G, Hardy GESJ and Burgess TI (2010) New Teratosphaeria species occurring on eucalypts in Australia. Fungal Diversity 43: 27-38.
- Rivera KG and Seifert KA (2011) A taxonomic and phylogenetic revision of the Penicillium sclerotiorum complex. Studies in Mycology 70: 139-158.
- Reference Strain
Cercospora apii IMI 077043, IMI 161116, MAFF 235978, MAFF 238072, MAFF 238299 Cercospora begoniae MAFF 237690 Cercospora beticola MAFF 238206, MAFF 305036 Cercospora capsici MAFF 238227 Cercospora citrullina MAFF 237872, MAFF 237913, MAFF 238205 Cercospora corchori MAFF 238191 Cercospora ipomoeae MAFF 239409 Cercospora kikuchii MAFF 305039, MAFF 305040 Cercospora lactucae-sativae MAFF 237719, MAFF 238209 Cercospora psophocarpicola MAFF 305757 Cercospora richardiicola MAFF 238210 Cercospora vignigena MAFF 237635 Cercospora zinniae MAFF 237718 Lasiodiplodia theobromae MAFF 238880 Rasamsonia cylindrospora IMI 071623, JCM 23136, NBRC 8110 Rasamsonia emersonii IFM 48182, IFM 52961, IMI 105413, IMI 116815, IMI 154228, JCM 23024, NBRC 31070, NBRC 31159, NBRC 31169, NBRC 31232