PriMicro Database

For classification, identification and molecular phylogenetic analyses of microbes

Primer Detail

Primer name
Bt2a
BT2a
bt2a
Gene name
β-Tubulin (BT/benA)
Primer sequence (5'-3')
GGTAACCAAATCGGTGCTGCTTTC
Direction
F
Target
filamentous ascomycetes
Reference
Glass NL, Donaldson GC (1995) Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Applied and Environmental Microbiology 61: 1323-1330.
Literature
A.J.L. Phillips, A. Alves, S.R. Pennycook, P.R. Johnston, A. Ramaley, A. Akulov and P.W. Crous (2008) Resolving the phylogenetic and taxonomic status of dark-spored teleomorph genera in the Botryosphaeriaceae. Persoonia 21: 29-55.
Panelli S. Buffoni JN, Bonacina C and Feligini M (2012) Identification of moulds from the Taleggio cheese environment by the use of DNA barcodes. Food Control 28: 385-391.
Houbraken J, Spierenburg H, Frisvad JC (2012) Rasamsonia, a new genus comprising thermotolerant and thermophilic Talaromyces and Geosmithia species. Antonie van Leeuwenhoek 101: 403-421.
López-Villavicencio M, Aguileta G, Giraud T, de Vienne DM, Lacoste S, Couloux A and Dupont J (2010) Sex in Penicillium: combined phylogenetic and experimental approaches. Fungal Genetics and Biology 47: 693-706.
Hong SB, Cho HS, Shin HD, Frisvad JC and Samson RA (2006) Novel Neosartorya species isolated from soil in Korea. International Journal of Systematic and Evolutionary Microbiology 56: 477-486.
Irene Barnes, Pedro W. Crous, Brenda D. Wingfield and Michael J. Wingfield (2004) Multigene phylogenies reveal that red band needle blight of Pinus is caused by two distinct species of Dothistroma, D. septosporum and D. pini. Studies in Mycology 50: 551-565.
Groenewald JZ, Nakashima C, Nishikawa J, Shin HD, Park JH, Jama AN, Groenewald M, Braun U and Crous PW (2013) Species concepts in Cercospora: spotting the weeds among the roses. Studies in Mycology 75: 115-170.
Davidson RM, Hanson LE, Franc GD and Panella L (2006) Analysis of β-tubulin gene fragments from benzimidazole sensitive and tolerant Cercospora beticola. Journal of Phytopathology 154: 321-328.
Andjic A, Whyte G, Hardy GESJ and Burgess TI (2010) New Teratosphaeria species occurring on eucalypts in Australia. Fungal Diversity 43: 27-38.
Rivera KG and Seifert KA (2011) A taxonomic and phylogenetic revision of the Penicillium sclerotiorum complex. Studies in Mycology 70: 139-158.
Reference Strain
Cercospora apiiIMI 077043, IMI 161116, MAFF 235978, MAFF 238072, MAFF 238299
Cercospora begoniaeMAFF 237690
Cercospora beticolaMAFF 238206, MAFF 305036
Cercospora capsiciMAFF 238227
Cercospora citrullinaMAFF 237872, MAFF 237913, MAFF 238205
Cercospora corchoriMAFF 238191
Cercospora ipomoeaeMAFF 239409
Cercospora kikuchiiMAFF 305039, MAFF 305040
Cercospora lactucae-sativaeMAFF 237719, MAFF 238209
Cercospora psophocarpicolaMAFF 305757
Cercospora richardiicolaMAFF 238210
Cercospora vignigenaMAFF 237635
Cercospora zinniaeMAFF 237718
Lasiodiplodia theobromaeMAFF 238880
Rasamsonia cylindrosporaIMI 071623, JCM 23136, NBRC 8110
Rasamsonia emersoniiIFM 48182, IFM 52961, IMI 105413, IMI 116815, IMI 154228, JCM 23024, NBRC 31070, NBRC 31159, NBRC 31169, NBRC 31232