PriMicro Database

For classification, identification and molecular phylogenetic analyses of microbes

Primer Detail

Primer name
H3-1a
Gene name
Histone 3
Primer sequence (5'-3')
ACTAAGCAGACCGCCCGCAGG
Direction
F
Target
filamentous ascomycetes
Reference
Glass NL, Donaldson GC (1995) Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Applied and Environmental Microbiology 61: 1323-1330.
Literature
Donaldson GC, Ball LA, Axelrood PE and Glass NL (1995) Primer sets developed to amplify conserved genes from filamentous ascomycetes are useful in differentiating fusarium species associated with conifers. Applied and Environmental Microbiology 61(4): 1331-1340.
Crous PW, Groenewald JZ, Pongpanich K, Himaman W, Arzanlou M and Wingfield MJ (2004) Cryptic speciation and host specificity among Mycosphaerella spp. occurring on Australian Acacia species grown as exotics in the tropics. Studies in Mycology 50: 457-469.
Crous PW, Groenewald JZ, Risède J-M, Simoneau P and Hywel-Jones NL (2004) Calonectria species and their Cylindrocladium anamorphs: species with sphaeropedunculate vesicles. Studies in Mycology 50: 415-430.
Groenewald JZ, Nakashima C, Nishikawa J, Shin HD, Park JH, Jama AN, Groenewald M, Braun U and Crous PW (2013) Species concepts in Cercospora: spotting the weeds among the roses. Studies in Mycology 75: 115-170.
KM Webb, PA Covey and LE Hanson (2012) Pathogenic and phylogenetic analysis of Fusarium oxysporum from sugarbeet in Michigan and Minnesota. Journal of Sugar Beet Research 49: 38-56.
Collado-Romero M, Mercado-Blanco J, Olivares-García C and Jiménez-Díaz RM (2008) Phylogenetic analysis of Verticillium dahliae vegetative compatibility groups. Phytopathology 98: 1019-1028.
Reference Strain
Cercospora apiiIMI 077043, IMI 161116, MAFF 235978, MAFF 238072, MAFF 238299
Cercospora begoniaeMAFF 237690
Cercospora beticolaMAFF 238206, MAFF 305036
Cercospora capsiciMAFF 238227
Cercospora citrullinaMAFF 237872, MAFF 237913, MAFF 238205
Cercospora corchoriMAFF 238191
Cercospora ipomoeaeMAFF 239409
Cercospora kikuchiiMAFF 305039, MAFF 305040
Cercospora lactucae-sativaeMAFF 237719, MAFF 238209
Cercospora psophocarpicolaMAFF 305757
Cercospora richardiicolaMAFF 238210
Cercospora vignigenaMAFF 237635
Cercospora zinniaeMAFF 237718
Lasiodiplodia theobromaeMAFF 238880