Primer Detail
- Primer name
- H3-1a
- Gene name
- Histone 3
- Primer sequence (5'-3')
- ACTAAGCAGACCGCCCGCAGG
- Direction
- F
- Target
- filamentous ascomycetes
- Reference
- Glass NL, Donaldson GC (1995) Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Applied and Environmental Microbiology 61: 1323-1330.
- Literature
- Donaldson GC, Ball LA, Axelrood PE and Glass NL (1995) Primer sets developed to amplify conserved genes from filamentous ascomycetes are useful in differentiating fusarium species associated with conifers. Applied and Environmental Microbiology 61(4): 1331-1340.
- Crous PW, Groenewald JZ, Pongpanich K, Himaman W, Arzanlou M and Wingfield MJ (2004) Cryptic speciation and host specificity among Mycosphaerella spp. occurring on Australian Acacia species grown as exotics in the tropics. Studies in Mycology 50: 457-469.
- Crous PW, Groenewald JZ, Risède J-M, Simoneau P and Hywel-Jones NL (2004) Calonectria species and their Cylindrocladium anamorphs: species with sphaeropedunculate vesicles. Studies in Mycology 50: 415-430.
- Groenewald JZ, Nakashima C, Nishikawa J, Shin HD, Park JH, Jama AN, Groenewald M, Braun U and Crous PW (2013) Species concepts in Cercospora: spotting the weeds among the roses. Studies in Mycology 75: 115-170.
- KM Webb, PA Covey and LE Hanson (2012) Pathogenic and phylogenetic analysis of Fusarium oxysporum from sugarbeet in Michigan and Minnesota. Journal of Sugar Beet Research 49: 38-56.
- Collado-Romero M, Mercado-Blanco J, Olivares-García C and Jiménez-Díaz RM (2008) Phylogenetic analysis of Verticillium dahliae vegetative compatibility groups. Phytopathology 98: 1019-1028.
- Reference Strain
Cercospora apii IMI 077043, IMI 161116, MAFF 235978, MAFF 238072, MAFF 238299 Cercospora begoniae MAFF 237690 Cercospora beticola MAFF 238206, MAFF 305036 Cercospora capsici MAFF 238227 Cercospora citrullina MAFF 237872, MAFF 237913, MAFF 238205 Cercospora corchori MAFF 238191 Cercospora ipomoeae MAFF 239409 Cercospora kikuchii MAFF 305039, MAFF 305040 Cercospora lactucae-sativae MAFF 237719, MAFF 238209 Cercospora psophocarpicola MAFF 305757 Cercospora richardiicola MAFF 238210 Cercospora vignigena MAFF 237635 Cercospora zinniae MAFF 237718 Lasiodiplodia theobromae MAFF 238880