PriMicro Database

For classification, identification and molecular phylogenetic analyses of microbes

Primer Detail

Primer name
CHS-354R
CHS-345R
Gene name
chitin synthase 1 (CHS-1)
Primer sequence (5'-3')
TGGAAGAACCATCTGTGAGAGTTG
Direction
R
Target
filamentous ascomycetes
Reference
Carbone I, Kohn LM (1999) A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 91: 553-556.
Literature
Groenewald JZ, Nakashima C, Nishikawa J, Shin HD, Park JH, Jama AN, Groenewald M, Braun U and Crous PW (2013) Species concepts in Cercospora: spotting the weeds among the roses. Studies in Mycology 75: 115-170.
BS Weir, PR Johnston and U Damm (2012) The Colletotrichum gloeosporioides species complex. Studies in Mycology 73: 115-180.
U Damm, PF Cannon, JHC Woudenberg and PW Crous (2012) The Colletotrichum acutatum species complex. Studies in Mycology 73: 37-113.
Toyozo Sato and Jouji Moriwaki (2013) Molecular re-identification of strains in NIAS Genebank belonging to phylogenetic groups A2 and A4 of the Colletotrichum acutatum species complex. Microbiology and Culture Collections 29: 13-23.
Reference Strain
Cercospora apiiIMI 077043, IMI 161116, MAFF 235978, MAFF 238072, MAFF 238299
Cercospora begoniaeMAFF 237690
Cercospora beticolaMAFF 238206, MAFF 305036
Cercospora capsiciMAFF 238227
Cercospora citrullinaMAFF 237872, MAFF 237913, MAFF 238205
Cercospora corchoriMAFF 238191
Cercospora ipomoeaeMAFF 239409
Cercospora kikuchiiMAFF 305039, MAFF 305040
Cercospora lactucae-sativaeMAFF 237719, MAFF 238209
Cercospora psophocarpicolaMAFF 305757
Cercospora richardiicolaMAFF 238210
Cercospora vignigenaMAFF 237635
Cercospora zinniaeMAFF 237718
Colletotrichum acutatumMAFF 238555, MAFF 744062, MAFF 744063
Colletotrichum carthamiMAFF 239356, MAFF 239357, MAFF 239358, MAFF 239359, MAFF 239360, MAFF 239361, MAFF 239362, MAFF 239364, MAFF 239365, MAFF 239366, MAFF 239367, MAFF 239368, MAFF 239369, MAFF 239370, MAFF 239371, MAFF 239372, MAFF 239373, MAFF 239374
Colletotrichum godetiaeMAFF 240289, MAFF 241295, MAFF 241296, MAFF 241297, MAFF 306506
Colletotrichum nymphaeaeMAFF 239773, MAFF 241261, MAFF 241294, MAFF 242413, MAFF 242414, MAFF 242415, MAFF 242416, MAFF 242417, MAFF 242418, MAFF 242419, MAFF 242581, MAFF 242590, MAFF 306406, MAFF 306407, MAFF 306430, MAFF 306487, MAFF 306488, MAFF 306503, MAFF 306505
Colletotrichum scovilleiMAFF 242420, MAFF 242421, MAFF 242422, MAFF 242425, MAFF 242426, MAFF 242427, MAFF 242428, MAFF 242592, MAFF 242692, MAFF 242693, MAFF 243021, MAFF 243022, MAFF 243038
Colletotrichum sloaneiMAFF 239736
Colletotrichum sp.(B)MAFF 237894, MAFF 306172
Colletotrichum sp.(C)MAFF 240237
Colletotrichum sp.(J)MAFF 237922, MAFF 306725, MAFF 306726, MAFF 410809
Lasiodiplodia theobromaeMAFF 238880