Primer Detail
- Primer name
- EF1-986R
EF986R
986R - Gene name
- translation elongation factor 1 alpha (EF-1α/TEF)
- Primer sequence (5'-3')
- TACTTGAAGGAACCCTTACC
- Direction
- R
- Target
- filamentous ascomycetes
- Reference
- Carbone I, Kohn LM (1999) A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 91: 553-556.
- Literature
- K. Tanaka, K. Hirayama, H. Yonezawa, S. Hatakeyama, Y. Harada, T. Sano, T. Shirouzu and T. Hosoya (2009) Molecular taxonomy of bambusicolous fungi: Tetraplosphaeriaceae, a new pleosporalean family with Tetraploa-like. Studies in Mycology 64: 175-209.
- A.J.L. Phillips, A. Alves, S.R. Pennycook, P.R. Johnston, A. Ramaley, A. Akulov and P.W. Crous (2008) Resolving the phylogenetic and taxonomic status of dark-spored teleomorph genera in the Botryosphaeriaceae. Persoonia 21: 29-55.
- Alves A, Crous PW, Correia A and Phillips AJL (2008) Morphological and molecular data reveal cryptic speciation in Lasiodiplodia theobromae. Fungal Diversity 28: 1-13.
- K Bensch, U Braun, JZ Groenewald and PW Crous (2012) The genus Cladosporium. Studies in Mycology 72: 1-401.
- Crous PW, Groenewald JZ, Pongpanich K, Himaman W, Arzanlou M and Wingfield MJ (2004) Cryptic speciation and host specificity among Mycosphaerella spp. occurring on Australian Acacia species grown as exotics in the tropics. Studies in Mycology 50: 457-469.
- Crous PW, Groenewald JZ, Risède J-M, Simoneau P and Hywel-Jones NL (2004) Calonectria species and their Cylindrocladium anamorphs: species with sphaeropedunculate vesicles. Studies in Mycology 50: 415-430.
- Irene Barnes, Pedro W. Crous, Brenda D. Wingfield and Michael J. Wingfield (2004) Multigene phylogenies reveal that red band needle blight of Pinus is caused by two distinct species of Dothistroma, D. septosporum and D. pini. Studies in Mycology 50: 551-565.
- Pedro W Crous, Johannes Z Groenewald, Marizeth Groenewald, Pat Caldwell, Uwe Braun and Thomas C Harrington (2006) Species of Cercospora associated with grey leaf spot of maize. Studies in Mycology 55: 189-197.
- Groenewald JZ, Nakashima C, Nishikawa J, Shin HD, Park JH, Jama AN, Groenewald M, Braun U and Crous PW (2013) Species concepts in Cercospora: spotting the weeds among the roses. Studies in Mycology 75: 115-170.
- Groenewald M, Groenewald JZ and Crous PW (2005) Distinct species exist within the Cercospora apii morphotype. Phytopathology 95: 951-959.
- Reference Strain
Astrosphaeriella aggregata MAFF 239485, MAFF 239486 Astrosphaeriella stellata MAFF 239487 Cercospora apii IMI 077043, IMI 161116, MAFF 235978, MAFF 238072, MAFF 238299 Cercospora begoniae MAFF 237690 Cercospora beticola MAFF 238206, MAFF 305036 Cercospora capsici MAFF 238227 Cercospora citrullina MAFF 237872, MAFF 237913, MAFF 238205 Cercospora corchori MAFF 238191 Cercospora ipomoeae MAFF 239409 Cercospora kikuchii MAFF 305039, MAFF 305040 Cercospora lactucae-sativae MAFF 237719, MAFF 238209 Cercospora psophocarpicola MAFF 305757 Cercospora richardiicola MAFF 238210 Cercospora vignigena MAFF 237635 Cercospora zinniae MAFF 237718 Kalmusia scabrispora JCM 12851, MAFF 239517, NBRC 106237 Katumotoa bambusicola JCM 13131, MAFF 239641 Lasiodiplodia theobromae MAFF 238880 Massarina arundinariae MAFF 239461, NBRC 106238, NBRC 106239 Ophiosphaerella sasicola JCM 13134, MAFF 239644 Phaeosphaeria brevispora MAFF 239276, NBRC 106240 Phaeosphaeria sp. NBRC 106255 Polyplosphaeria fusca JCM 13173, JCM 13175, JCM 13176, JCM 13177, MAFF 239683, MAFF 239685, MAFF 239686, MAFF 239687 Pseudotetraploa curviappendiculata JCM 12852, MAFF 239495, MAFF 239496, NBRC 106241 Pseudotetraploa javanica JCM 12854, MAFF 239498 Pseudotetraploa longissima JCM 12853, MAFF 239497 Quadricrura meridionalis NBRC 106242 Quadricrura septentrionalis NBRC 106243, NBRC 106244 Roussoella hysterioides JCM 13126, MAFF 239636 Roussoella pustulans JCM 13127, MAFF 239637 Roussoella sp. NBRC 106245 Roussoellopsis sp. NBRC 106246 Roussoellopsis tosaensis JCM 13128, MAFF 239638 Tetraploa sp. JCM 14424, NBRC 106251 Tetraplosphaeria nagasakiensis JCM 13168, MAFF 239678 Tetraplosphaeria sasicola JCM 13167, MAFF 239677 Triplosphaeria cylindrica JCM 13169, JCM 14425, MAFF 239679, NBRC 106247 Triplosphaeria maxima JCM 13172, MAFF 239682 Triplosphaeria sp. NBRC 106248, NBRC 106249 Trisplophaeria acuta JCM 13171, MAFF 239681 Versicolorisporium triseptatum JCM 14775