Primer Detail
- Primer name
- ML8
- Gene name
- Mitochondrial large rRNA gene
- Primer sequence (5'-3')
- TTATCCCTAGCGTAACTTTTATC
- Direction
- R
- Target
- Fungi
- Reference
- White, T. J., Bruns, T., Lee, S. and Taylor, J. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications, eds. Innis, M. A., D. H. Gelfand, J. J. Sninsky, and T. J. White. Academic Press, Inc., New York. 315-322.