Primer Detail
- Primer name
- ML4
- Gene name
- Mitochondrial large rRNA gene
- Primer sequence (5'-3')
- GAGGATAATTTGCCGAGTTCC
- Direction
- R
- Target
- Fungi
- Reference
- White, T. J., Bruns, T., Lee, S. and Taylor, J. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications, eds. Innis, M. A., D. H. Gelfand, J. J. Sninsky, and T. J. White. Academic Press, Inc., New York. 315-322.
- Literature
- H. Thorsten Lumbsch,Imke Schmitt, Ralf Lindemuth, Andrew Miller, Armin Mangold, Fernando Fernandez and Sabine Huhndorf (2005) Performance of four ribosomal DNA regions to infer higher-level phylogenetic relationships of inoperculate euascomycetes (Leotiomyceta). Molecular Phylogenetics and Evolution 34: 512-524.