PriMicro Database

For classification, identification and molecular phylogenetic analyses of microbes

Primer Detail

Primer name
SR11R
Gene name
18S rRNA gene (SSU)
Primer sequence (5'-3')
GGAGCCTGAGAAACGGCTAC
Direction
F
Target
Fungi
Reference
Spatafora JW, Mitchell TG, Vilgalys R (1995) Analysis of genes encoding for small-subunit rRNA sequences in studying phylogenetics of dematiaceous fungal pathogens. Journal of Clinical Microbiology 33: 1322-1326.
Literature
P.W. Crous, C.L. Schoch, K.D. Hyde, A.R. Wood, C. Gueidan, G.S. de Hoog and J.Z. Groenewald (2009) Phylogenetic lineages in the Capnodiales. Studies in Mycology 64: 17-47.
C. Ruibal, C. Gueidan, L. Selbmann, A.A. Gorbushina, P.W. Crous, J.Z. Groenewald, L. Muggia, M. Grube, D. Isola, C.L. Schoch, J.T. Staley, F. Lutzoni and G.S. de Hoog (2009) Phylogeny of rock-inhabiting fungi related to Dothideomycetes. Studies in Mycology 64: 123-133.
Frank Kauff and François Lutzoni (2002) Phylogeny of the Gyalectales and Ostropales (Ascomycota, Fungi): among and within order relationships based on nuclear ribosomal RNA small and large subunits. Molecular Phylogenetics and Evolution 25: 138-156.
Jolanta Miadlikowska and François Lutzoni (2004) Phylogenetic classification of Peltigeralean fungi (Peltigerales, Ascomycota) based on ribosomal RNA small and large subunits. American Journal of Botany 91(3): 449-464.
http://www.lutzonilab.net/primers/page244.shtml
Valérie Reeb, François Lutzoni and Claude Roux (2004) Contribution of RPB2 to multilocus phylogenetic studies of the euascomycetes (Pezizomycotina, Fungi) with special emphasis on the lichen-forming Acarosporaceae and evolution of polyspory. Molecular Phylogenetics and Evolution 32: 1036-1060.
M Réblová, W Gams and KA Seifert (2011) Monilochaetes and allied genera of the Glomerellales, and a reconsideration of families in the Microascales. Studies in Mycology 68: 163-191.