Primer Detail
- Primer name
- NS24
NS24UCB
nu-SSU-1750-3'
- Gene name
- 18S rRNA gene (SSU)
- Primer sequence (5'-3')
- AAACCTTGTTACGACTTTTA
- Direction
- R
- Target
- Fungi
- Reference
- Gargas A, Taylor JW (1992) Polymerase chain reaction (PCR) primers for amplifying and sequencing 18S rDNA from lichenized fungi. Mycologia 84(4): 589-592.
- Literature
- P.W. Crous, C.L. Schoch, K.D. Hyde, A.R. Wood, C. Gueidan, G.S. de Hoog and J.Z. Groenewald (2009) Phylogenetic lineages in the Capnodiales. Studies in Mycology 64: 17-47.
- G. S. de Hoog and A. H. G. Gerrits van den Ende (1998) Molecular diagnostics of clinical strains of filamentous Basidiomycetes. Mycoses 41: 183-189.
- C. Ruibal, C. Gueidan, L. Selbmann, A.A. Gorbushina, P.W. Crous, J.Z. Groenewald, L. Muggia, M. Grube, D. Isola, C.L. Schoch, J.T. Staley, F. Lutzoni and G.S. de Hoog (2009) Phylogeny of rock-inhabiting fungi related to Dothideomycetes. Studies in Mycology 64: 123-133.
- Frank Kauff and François Lutzoni (2002) Phylogeny of the Gyalectales and Ostropales (Ascomycota, Fungi): among and within order relationships based on nuclear ribosomal RNA small and large subunits. Molecular Phylogenetics and Evolution 25: 138-156.
- Hofstetter V, Miadlikowska J, Kauff F, Lutzoni F (2007) Phylogenetic comparison of protein-coding versus ribosomal RNA-coding sequence data: a case study of the Lecanoromycetes (Ascomycota). Molecular Phylogenetics and Evolution 44: 412-426.
- Gargas, A. and DePriest, P. T. (1996) A nomenclature for fungal PCR primers with examples from intron-containing SSU rDNA. Mycologia 88: 745-748.
- Gargas, A. P.T. DePriest and J.W. Taylor (1995) Positions of multiple insertions in SSU rDNA of lichen-forming fungi. Molecular Biology and Evolution 12: 208-218.
- http://www.lutzonilab.net/primers/page244.shtml
- Wendy A. Untereiner, Cécile Gueidan, Mary-Jane Orr and Paul Diederich (2011) The phylogenetic position of the lichenicolous ascomycete Capronia peltigerae. Fungal Diversity 49: 225-233.
- M Réblová, W Gams and KA Seifert (2011) Monilochaetes and allied genera of the Glomerellales, and a reconsideration of families in the Microascales. Studies in Mycology 68: 163-191.
- Simon UK, Groenewald JZ and Crous PW (2009) Cymadothea trifolii, an obligate biotrophic leaf parasite of Trifolium, belongs to Mycosphaerellaceae as shown by nuclear ribosomal DNA analyses. Persoonia 22: 49-55.
- X-Z Liu, Q-M Wang, B Theelen, M Groenewald, F-Y Bai and T Boekhout (2015) Phylogeny of tremellomycetous yeasts and related dimorphic and filamentous basidiomycetes reconstructed from multiple gene sequence analyses. Studies in Mycology 81: 1-26.
