Primer Detail
- Primer name
- NS23
NS23UCB
nu-SSU-1203-5'
- Gene name
- 18S rRNA gene (SSU)
- Primer sequence (5'-3')
- GACTCAACACGGGGAAACTC
- Direction
- F
- Target
- Fungi
- Reference
- Gargas A, Taylor JW (1992) Polymerase chain reaction (PCR) primers for amplifying and sequencing 18S rDNA from lichenized fungi. Mycologia 84(4): 589-592.
- Literature
- P.W. Crous, C.L. Schoch, K.D. Hyde, A.R. Wood, C. Gueidan, G.S. de Hoog and J.Z. Groenewald (2009) Phylogenetic lineages in the Capnodiales. Studies in Mycology 64: 17-47.
- Gregory S. Saenz and John W. Taylor (1999) Phylogenetic relationships of Meliola and Meliolina inferred from nuclear small subunit rRNA sequences. Mycological Research 103(8): 1049-1056.
- C. Ruibal, C. Gueidan, L. Selbmann, A.A. Gorbushina, P.W. Crous, J.Z. Groenewald, L. Muggia, M. Grube, D. Isola, C.L. Schoch, J.T. Staley, F. Lutzoni and G.S. de Hoog (2009) Phylogeny of rock-inhabiting fungi related to Dothideomycetes. Studies in Mycology 64: 123-133.
- Frank Kauff and François Lutzoni (2002) Phylogeny of the Gyalectales and Ostropales (Ascomycota, Fungi): among and within order relationships based on nuclear ribosomal RNA small and large subunits. Molecular Phylogenetics and Evolution 25: 138-156.
- Gargas, A. and DePriest, P. T. (1996) A nomenclature for fungal PCR primers with examples from intron-containing SSU rDNA. Mycologia 88: 745-748.
- http://www.lutzonilab.net/primers/page244.shtml
- Simon UK, Groenewald JZ and Crous PW (2009) Cymadothea trifolii, an obligate biotrophic leaf parasite of Trifolium, belongs to Mycosphaerellaceae as shown by nuclear ribosomal DNA analyses. Persoonia 22: 49-55.