Primer Detail
- Primer name
- NS20
NS20UCB
nu-SSU-0852-3'
- Gene name
- 18S rRNA gene (SSU)
- Primer sequence (5'-3')
- CGTCCCTATTAATCATTACG
- Direction
- R
- Category
- fungus-specific
- Target
- Fungi
- Reference
- Gargas A, Taylor JW (1992) Polymerase chain reaction (PCR) primers for amplifying and sequencing 18S rDNA from lichenized fungi. Mycologia 84(4): 589-592.
- Literature
- P.W. Crous, C.L. Schoch, K.D. Hyde, A.R. Wood, C. Gueidan, G.S. de Hoog and J.Z. Groenewald (2009) Phylogenetic lineages in the Capnodiales. Studies in Mycology 64: 17-47.
- Gregory S. Saenz and John W. Taylor (1999) Phylogenetic relationships of Meliola and Meliolina inferred from nuclear small subunit rRNA sequences. Mycological Research 103(8): 1049-1056.
- Gargas, A. and DePriest, P. T. (1996) A nomenclature for fungal PCR primers with examples from intron-containing SSU rDNA. Mycologia 88: 745-748.
- http://www.lutzonilab.net/primers/page244.shtml
- Leena Myllys, Katileena Lohtander, Mari Källersjö and Anders Tehler (1999) Sequence insertion and ITS data provide congruent information in Roccella canariensis and R. tuberculata (Arthoniales, Euascomycetes) phylogeny. Molecular Phylogenetics and Evolution 12: 295-309.
- Dirk Redecker, Joseph B. Morton and Thomas D. Bruns (2000) Ancestral lineages of arbuscular mycorrhizal fungi (Glomales). Molecular Phylogenetics and Evolution 14: 276-284.
- Simon UK, Groenewald JZ and Crous PW (2009) Cymadothea trifolii, an obligate biotrophic leaf parasite of Trifolium, belongs to Mycosphaerellaceae as shown by nuclear ribosomal DNA analyses. Persoonia 22: 49-55.
