Primer Detail
- Primer name
- ITS1F
ITS1-F
ITS1-f
- Gene name
- ITS1-5.8S-ITS2 rRNA gene (ITS)
- Primer sequence (5'-3')
- CTTGGTCATTTAGAGGAAGTAA
- Direction
- F
- Category
- specific primer
- Target
- Fungi
- Paired primer
- NLB3 LB-W LA-W LR5-Tom LR5-Seb LR3-Tul
- Reference
- M gardes and TD Bruns (1993) ITS primers with enhanced specificity for basidiomycetes - application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113-118.
- Literature
- P.W. Crous, C.L. Schoch, K.D. Hyde, A.R. Wood, C. Gueidan, G.S. de Hoog and J.Z. Groenewald (2009) Phylogenetic lineages in the Capnodiales. Studies in Mycology 64: 17-47.
- Prachand Shrestha, Timothy M. Szaro, Thomas D. Bruns and John W. Taylor (2011) Systematic search for cultivatable fungi that best deconstruct cell walls of Miscanthus and sugarcane in the field. Applied and Environmental Microbiology 77(15): 5490-5504.
- James Borneman and R. Jack Hartin (2000) PCR primers that amplify fungal rRNA genes from environmental samples. Applied and Environmental Microbiology 66(10): 4356-4360.
- Kendall J Martin and Paul T Rygiewicz (2005) Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts. BMC Microbiology 5: 28e.
- http://www.lutzonilab.net/primers/page244.shtml
- Tina C. Summefield and Julian J. Eaton-Rye (2006) Pseudocyphellaria crocata, P. neglecta and P. perpetua from the Northern and Southern Hemispheres are a phylogenetic species and share cyanobiont. New Phytologist 170: 597-607.
- Myllys, L., Lohtander, K. and Tehler, A (2001) β-tublin, ITS and group I intron sequences challenge the species pair concept in Physcia aipolia and P. caesia. Mycologia 93: 335-343.
- Leena Myllys, Katileena Lohtander, Mari Källersjö and Anders Tehler (1999) Sequence insertion and ITS data provide congruent information in Roccella canariensis and R. tuberculata (Arthoniales, Euascomycetes) phylogeny. Molecular Phylogenetics and Evolution 12: 295-309.
- Sokolski S, Piché Y, Chauvet E and Bérubé JA (2006) A fungal endophyte of black spruce (Picea mariana) needles is also an aquatic hyphomycete. Molecular Ecology 15(7): 1955-1962.
- Valášková V and Baldrian P (2009) Denaturing gradient gel electrophoresis as a fingerprinting method for the analysis of soil microbial communities. JournalPlant, Soil and Environment 55(10): 413-423.
- Anderson IC, Campbell CD and Prosser JI (2003) Diversity of fungi in organic soils under a moorland ? Scots pine (Pinus sylvestris L.) gradient. Environmental Microbiology 5: 1121-1132.
- Arenz BE, Held BW, Jurgens JA, Farrell RL and Blanchette RA (2006) Fungal diversity in soils and historic wood from the Ross Sea Region of Antarctica. Soil Biology and Biochemistry 38: 3057-3064.
- Larena I, Salazar O, González V, Julián MC and Rubio V (1999) Design of a primer for ribosomal DNA internal transcribed spacer with enhanced specificity for ascomycetes. Journal of Biotechnology 75: 187-194.
- Dirk Redecker (2000) Specific PCR primers to identify arbuscular mycorrhizal fungi within colonized roots. Mycorrhiza 10: 73-80.
- Dirk Redecker, Joseph B. Morton and Thomas D. Bruns (2000) Ancestral lineages of arbuscular mycorrhizal fungi (Glomales). Molecular Phylogenetics and Evolution 14: 276-284.
- Martin I. Bidartondo, Dirk Redecker, Isabelle Hijri, Andres Wiemken, Thomas D. Bruns, Laura Domínguez, Alicia Sérsic, Jonathan R. Leake and David J. Read (2002) Epiparasitic plants specialized on arbuscular mycorrhizal fungi. Nature 419: 389-392.
- Alga Zuccaro, Conrad L. Schoch, Joseph W. Spatafora, Jan Kohlmeyer, Siegfried Draeger and Julian I. Mitchell (2008) Detection and Identification of Fungi Intimately Associated with the Brown Seaweed Fucus serratus. Applied and Environmental Microbiology 74(4): 931-941.
- Macia-Vicente JG, Ferraro V, Burruano S and Lopez-Llorca LV (2012) Fungal assemblages associated with roots of halophytic and non-halophytic plant species vary differentially along a salinity gradient. Microbial Ecology 63: 668-679.
- Collado J, Platas G, Paulus B and Bills GF (2007) High-throughput culturing of fungi from plant litter by a dilution-to-extinction technique. FEMS Microbiology Ecology 60(3): 521-533.
- Wirsel SG, Runge-Frobose C, Ahren DG, Kemen E amd Oliver RP (2002) Four or more species of Cladosporium sympatrically colonize Phragmites australis. Fungal Genetics and Biology 35: 99-113.
- Andjic A, Whyte G, Hardy GESJ and Burgess TI (2010) New Teratosphaeria species occurring on eucalypts in Australia. Fungal Diversity 43: 27-38.
- Xu Z, Harrington TC, Gleason ML and Batzer JC (2010) Phylogenetic placement of plant pathogenic Sclerotium species among teleomorph genera. Mycologia 102: 337-346.
- Matheny PB, Wang Z, Binder M, Curtis JM, Lim YW, Nilsson RH, Hughes KW, Hofstetter V, Ammirati JF, Schoch CL, Langer E, Langer G, McLaughlin DJ, Wilson AW, Frøslev T, Ge ZW, Kerrigan RW, Slot JC, Yang ZL, Baroni TJ, Fischer M, Hosaka K, Matsuura K, Seidl MT, Vauras J and Hibbett DS (2007) Contributions of rpb2 and tef1 to the phylogeny of mushrooms and allies (Basidiomycota, Fungi). Molecular Phylogenetics and Evolution 43: 430-451.
- BS Weir, PR Johnston and U Damm (2012) The Colletotrichum gloeosporioides species complex. Studies in Mycology 73: 115-180.
- Emilie F Fradin, Ahmed Abd-El-Haliem, Laura Masini, Grardy CM van den Berg, Matthieu HAJ Joosten and Bart PHJ Thomma (2011) Interfamily transfer of tomato Ve1 mediates Verticillium resistance in Arabidopsis. Plant Physiology 156: 2255-2265.
- Guido Schnabel, Joshua S Ash and Patricia K Bryson (2005) Identification and characterization of Armillaria tabescens from the southeastern United States. Mycological Research 109: 1208-1222.
- A Shi, SK Kantartzi, MT Mmbaga, P Chen, F Mrema and E Nnodu (2008) PCR-based markers for detection of Colletotrichum acutatum and C. gloeosporioides in flowering dogwood (Cornus florida). Australasian Plant Pathology 37: 65-68.
- U Damm, PF Cannon, JHC Woudenberg and PW Crous (2012) The Colletotrichum acutatum species complex. Studies in Mycology 73: 37-113.
- Tony Vancov and Brad Keen (2009) Amplification of soil fungal community DNA using the ITS86F and ITS4 primers. FEMS Microbiology Letters 296: 91-96.
- Toju H, Tanabe AS, Yamamoto S and Sato H (2012) High-coverage ITS primers for the DNA-based identification of ascomycetes and basidiomycetes in environmental samples. PLoS One 6: e40863.
- Leho Tederso, Teele Jairus, Bryony M Horton, Kessy Abarenkov, Triin Suvi, Irja Saar and Urmas Kõljalg (2008) Strong host preference of ectomycorrhizal fungi in a Tasmanian wet sclerophyll forest as revealed by DNA barcoding and taxon-specific primers. New Phytologist 180: 479-490.
- Peng Zhao, Makoto Kakishima, Shihomi Uzuhashi and Hideo Ishii (2012) Multigene phylogenetic analysis of inter- and intraspecific relationships in Venturia nashicola and V. pirina. European Journal of Plant Pathology 132: 245-258.
