Primer Detail
- Primer name
- FF1
- Gene name
- 18S rRNA gene (SSU)
- Primer sequence (5'-3')
- GTTAAAAAGCTCGTAGTTGAAC
- Direction
- F
- Category
- specific primer
- Target
- Fungi
- Paired primer
- FR1
- Reference
- G. Zhou, W.-Z. Whong, T. Ong and B. Chen (2000) Development of a fungus-specific PCR assay for detecting low-level fungi in an indoor environment. Molecular and Cellular Probes 14: 339-348.
- Literature
- Tina A. Hofmann & Roland Kirschner and Meike Piepenbring (2010) Phylogenetic relationships and new records of Asterinaceae (Dothideomycetes) from Panama. Fungal Diversity 43: 39-53.
- Tina A. Hofmann (2009) Plant parasitic Asterinaceae and Microthyriaceae from the Neotropics (Panama). Dissertation