Primer Detail
- Primer name
- AMF1
- Gene name
- Apn2-Mat1-2 intergenic spacer and partial mating type Mat1-2 gene (ApMat)
- Primer sequence (5'-3')
- CCAGAAATACACCGAACTTGC
- Direction
- F
- Category
- specific primer
- Target
- fungi
- Paired primer
- AMR1
- Reference
- Silva, D.N., Talhinhas, P., Várzea, V., Cai, L. (2012) Application of the Apn2/MAT locus to improve the systematics of the Colletotrichum gloeosporioides complex: an example from coffee (Coffea spp.) hosts. Mycologia 104: 396–409.
- Literature
- Liu, F., Ma, Z.Y., Hou, L.W., Diao, Y.Z., Wu, W.P., Damm, U., Song, S. and Cai, L. (2022) Updating species diversity of Colletotrichum, with a phylogenomic overview. Studies in Mycology 101: 1–56.
- Yokosawa, S., Eguchi, N., Kondo, K. and Sato, T. (2017) Phylogenetic relationship and fungicide sensitivity of members of the Colletotrichum gloeosporioides species complex from apple. Journal of General Plant Pathology 83: 291–298.
- Yokosawa, S., Eguchi, N. and Sato, T. (2020) Characterization of the Colletotrichum gloeosporioides species complex causing grape ripe rot in Nagano Prefecture, Japan. Journal of General Plant Pathology 86: 163–172.
- Reference Strain
Colletotrichum aenigma MAFF 244310 Colletotrichum fructicola MAFF 244305, MAFF 244312, MAFF 244313, MAFF 244314, MAFF 244317, MAFF 244669, MAFF 244670, MAFF 244671, MAFF 244672, MAFF 244673, MAFF 244674, MAFF 244675 Colletotrichum perseae MAFF 246969, MAFF 246971, MAFF 246974, MAFF 246975, MAFF 246977, MAFF 246978, MAFF 246981, MAFF 246982, MAFF 246988 Colletotrichum siamense MAFF 244304, MAFF 244306, MAFF 244307, MAFF 244308, MAFF 244309, MAFF 244316, MAFF 244676, MAFF 244677 Colletotrichum sp. MAFF 244315, MAFF 246970, MAFF 246976, MAFF 246985, MAFF 246989, MAFF 246990, MAFF 246993, MAFF 246995, MAFF 246996 Colletotrichum viniferum MAFF 246968, MAFF 246986, MAFF 246987, MAFF 246991, MAFF 246992, MAFF 246994