Primer Detail
- Primer name
- 1pYp-F
- Gene name
- pla (pla)
- Primer sequence (5'-3')
- ATACTGTGACGGCGGGTCTGCA
- Direction
- F
- Category
- specific primer
- Target
- Bacteria
- Paired primer
- 1pYp-R
- Reference
- Ezaki, T., Kanazawa, I., Hayashi, S.. Hayashi, M., Eldesoky, I. and Fukunaga, H. (2016) A cocktail PCR and DNA strip method for quick confirmation of multiple pathogenic factors in BSL3 stock cultures.. Microbial Resources and Systematics 32: 123-131.