Primer Detail
- Primer name
- 1CSeT-F
- Gene name
- CRISPR2 (CRISPR2)
- Primer sequence (5'-3')
- ACGTAGACTCATCCTCGACC
- Direction
- F
- Category
- specific primer
- Target
- Bacteria
- Paired primer
- 1CSeT-R
- Reference
- Fabre, L., Le Hello, S., Roux, C., Issenhuth-Jeanjean, S. and Weill, F.-X. (2014) CRISPR is an optimal target for the design of specific PCR assays for Salmonella enterica serotypes Typhi and Paratyphi A.. PLOS Neglected Tropical Diseases 8: e2671.
- Literature
- Ezaki, T., Kanazawa, I., Hayashi, S.. Hayashi, M., Eldesoky, I. and Fukunaga, H. (2016) A cocktail PCR and DNA strip method for quick confirmation of multiple pathogenic factors in BSL3 stock cultures.. Microbial Resources and Systematics 32: 123-131.