PriMicro Database

For classification, identification and molecular phylogenetic analyses of microbes

Primer Detail

Gene name
mitochondrially encoded cytochrome oxidase II genes (cox2)
Primer sequence (5'-3')
CCATGATTAATACCACAAATTTCACTAC
Direction
R
Reference
Hudspeth DSS, Nadler SA and Hudspeth MES (2000) A cox2 molecular phylogeny of the peronosporomycetes. Mycologia 92: 674-684.
Literature
Xavier Giresse, Sophia Ahmed, Sylvie Richard-Cervera and Fran├žois Delmotte (2010) Development of New Oomycete Taxon-specific Mitochondrial Cytochrome b Region Primers for Use in Phylogenetic and Phylogeographic Studies. Journal of Phytopathology 158: 321-327.